double-barcoded dna array  (PROTEINA Co Ltd)

Journal: Genome Research

Article Title: Tissular chromatin-state cartography based on double-barcoded DNA arrays that capture unloaded PA-Tn5 transposase

doi: 10.1101/gr.280305.124

Figure Lengend Snippet: Principle behind the double-barcoded spatial epigenomic technology. ( A ) DNA arrays are printed by depositing first probes in rows, followed by deposition of a second type of probes in columns. The first type of probe is composed of a T7 promoter (T7p) sequence, a unique molecular barcode associated to the row (BCr1, …BCri), and bridge sequence called “Gibson.” The second type of probe presents a complementary Gibson sequence, a unique molecular barcode associated to the column (BCc1, …BCcj), and a complementary mosaic sequence (MOS′). ( B ) Because both probes were combined during printing, after UV irradiation for immobilization, hybridized probes are elongated with the T4 DNA polymerase, leading to a double-strand molecule presenting the mosaic sequence (MOS) at the free end of the probe. ( C ) After depositing a tissue section on top of the manufactured DNA array, a first antibody against the protein of interest is incubated, followed by a second antibody against the first antibody, and is finally incubated with the recombinant Protein A–transposase PA-Tn5. ( D ) Scheme illustrating the loading of the Tn5 into the mosaic sequence retrieved on the printed probes on the DNA array, followed by the chromatin cleavage induced by magnesium chloride, leading to the formation of hairpin-like DNA structures. ( E ) Scheme illustrating the molecular biology steps required for generating a copy of the genomic DNA captured by the DNA probes, followed by their amplification for Illumina massive parallel DNA sequencing.

Article Snippet: Like in our previous study describing the use of double-barcoded DNA arrays for spatial transcriptomics , we have used BCr oligonucleotides presenting an amino C6 linker at the 5′ extremity, followed by four G or C nucleotides (S), a T7 promoter sequence (GACTCGTAATACGACTCACTATAGGG), a unique molecular identifier (UMI; WSNNWSNNV), a molecular barcode (8 nt) associated to the printed row in the DNA array, and a 30 nt adapter sequence with a GC-content of 40% (here named as Gibson sequence “ACATTGAAGAACCTG-TAGATAACTCGCTGT”).

Techniques: Sequencing, Irradiation, DNA Array, Incubation, Recombinant, Amplification, DNA Sequencing

Journal: Genome Research

Article Title: Tissular chromatin-state cartography based on double-barcoded DNA arrays that capture unloaded PA-Tn5 transposase

doi: 10.1101/gr.280305.124

Figure Lengend Snippet: Spatial epigenomic profiling over a whole-mouse brain section. ( A ) Micrograph displaying the scanning of a mouse brain coronal section deposited on top of a DNA array composed of 64 × 32 interstitial printed probes harboring the mosaic sequence. Three rows of Cy3-labeled probes are visible at the border of the micrograph, corresponding to fiducials used for defining the physical position of the tissue section across the 4096 printed probes. Notice that the DNA array covers a surface of 16 × 8 mm. ( B ) Micrograph displaying a bright-field scanning of a DNA array printed area in which each of the printed probes is visible as a result of salt deposition. Due to the interstitial printing, the pitch distance resolution of the array is ∼177 microns. ( C ) Immunolabeling of the section displayed in A , revealing the histone modification H3K4me3. The inset magnification area reveals the nuclear staining visible through this labeling, as well as the differences in cell density across different parts of the mouse brain section. ( D ) Electropherogram displaying the spatial epigenomic (SpE) Illumina sequencing library obtained from the mouse brain section. ( E ) Number of total sequenced reads, as well as those recovered at different stages of the primary bioinformatics analysis. ( F ) Violin plots displaying the number of read counts or promoter regions per spatial epigenomic element (SpExel), in analogy to picture elements (pixels). ( G ) Digital display corresponding to the number of adjusted read counts associated to the physical positions in the mouse brain section (heatmap displayed in logarithmic scale). ( H ) Venn diagram displaying the number of promoters presenting H3K4me3 peaks in common between the SpE map and two bulk H3K4me3 ChIP-sequencing profiles ( GSM1656749 , GSM1000095 ). For this comparison, all mapped reads across the tissue were collapsed to generate a pseudobulk profile and processed with the peak caller MACS2 ( P -value < 1 × 10 −5 ). ( I ) Peak-centered heatmap for the H3K4me3 peaks retrieved in common between the SpE map and both bulk data sets. Insets display average peak density retrieved in nine peak classes generated from peak clustering based on their shape. ( J ) Common peaks retrieved between the spatial H3K4me3 profile and the spatial data published by ( GSM5622964 ). Notice that more than 5000 to 8000 peaks are retrieved in common, on the grounds of the confidence threshold used for the comparison (MACS2 peak calling applied on the corresponding pseudobulk data). ( K ) Genome browser views assessed around the promoter region associated to the gene adenyl cyclase ( Adcy5 ). ( Top ) Bulk ChIP-sequencing data from mouse brain samples and visualized within the QC Genomics genome browser. Heatmap on the bottom of each profile corresponds to a local QC enrichment assessment . ( Bottom ) Pseudobulk enrichment profiles issued either from the public data set generated by ( GSM5622964 ; blue) or from the H3K4me3 enrichment map generated in this study (black). ( L ) Spatial H3K4me3 enrichment signatures retrieved in the promoter region associated to the gene Adcy5 . ( M ) Same as L , but expressed in a differential enrichment context relative to the average levels across the tissue. ( N ) Mouse brain tissue section analyzed by and the corresponding H3K4me3 enrichment spatial signature associated to the gene Adcy5 . Image adapted from . ( O ) In situ hybridization (ISH) on a mouse brain section for the gene Adcy5 (Allen Mouse Brain Atlas).

Article Snippet: Like in our previous study describing the use of double-barcoded DNA arrays for spatial transcriptomics , we have used BCr oligonucleotides presenting an amino C6 linker at the 5′ extremity, followed by four G or C nucleotides (S), a T7 promoter sequence (GACTCGTAATACGACTCACTATAGGG), a unique molecular identifier (UMI; WSNNWSNNV), a molecular barcode (8 nt) associated to the printed row in the DNA array, and a 30 nt adapter sequence with a GC-content of 40% (here named as Gibson sequence “ACATTGAAGAACCTG-TAGATAACTCGCTGT”).

Techniques: DNA Array, Sequencing, Labeling, Immunolabeling, Modification, Staining, Illumina Sequencing, ChIP-sequencing, Comparison, Generated, In Situ Hybridization

Journal: Genome Research

Article Title: Tissular chromatin-state cartography based on double-barcoded DNA arrays that capture unloaded PA-Tn5 transposase

doi: 10.1101/gr.280305.124

Figure Lengend Snippet: Spatial epigenomic assay in decalcified FFPE tissues. ( A ) Strategy for analyzing mice paw tissues from a collagen-induced arthritis (CIA) model. ( B ) Representative mouse paw tissue section revealing the presence of the tibia, talus, navicular, cuneiform, and metatarsus bone. ( C ) H3K27-acetylation (H3K27ac) spatial epigenomic profiling performed on a mouse paw tissue section deposited on a double-barcoded DNA array (64 × 32 printed probes). ( D ) Number of total sequenced reads and those recovered at different stages of the primary bioinformatics analysis. ( E ) Violin plots displaying the number of read counts or promoter regions per SpExel. ( F ) Digital view of the normalized and adjusted number of read counts associated to the physical location (SpExel) of the tissue section. ( G ) T-distributed stochastic neighbor embedding dimensionality reduction analysis (t-SNE) displaying the presence of six clusters of SpExel; ( H ) Clusters’ projection on top of the physical position within the tissue. ( I ) Cell type gene marker association analysis performed per clusters identified in G . Relevant cell types retrieved enriched per cluster are highlighted (green boxes). ( J ) Example of gene promoters found enriched in H3K27ac read counts and associated to the aforementioned clusters. Cell type annotations indicated are collected from the CellMarker augmented database used for this analysis. ( K ) Scheme of the CIA immunization assay performed by , allowing the collection of bulk-transcriptomics data from mice paw soft tissue at different time points. ( L ) Heatmap revealing differential gene expression signatures from the soft-tissue transcriptomes and classified in seven gene coexpression paths. Along the public transcriptome, the detection of H3K27ac overenrichment across the decalcified FFPE mouse paw section (number of overenriched SpExel) is displayed (blue heatmap). ( M ) Fraction of common genes between those associated to one of the gene coexpression paths in L and those presenting a H3K27ac enrichment in the spatial epigenomic map. Notice that only H3K27ac overenriched promoters (log-fold change [LFC]>1) being present in >1%, >5%, or >10% of total SpExel across the section were considered in this analysis.

Article Snippet: Like in our previous study describing the use of double-barcoded DNA arrays for spatial transcriptomics , we have used BCr oligonucleotides presenting an amino C6 linker at the 5′ extremity, followed by four G or C nucleotides (S), a T7 promoter sequence (GACTCGTAATACGACTCACTATAGGG), a unique molecular identifier (UMI; WSNNWSNNV), a molecular barcode (8 nt) associated to the printed row in the DNA array, and a 30 nt adapter sequence with a GC-content of 40% (here named as Gibson sequence “ACATTGAAGAACCTG-TAGATAACTCGCTGT”).

Techniques: DNA Array, Marker, Gene Expression

Journal: Genome Research

Article Title: Tissular chromatin-state cartography based on double-barcoded DNA arrays that capture unloaded PA-Tn5 transposase

doi: 10.1101/gr.280305.124

Figure Lengend Snippet: Inferring chromatin-state transitions across the mouse embryo by integrating consecutive spatial epigenomic landscapes. ( A , left ) Scan of a DNA array (TRITC filter) hosting a cryosection of a mouse embryo (E11.5) and immunostained with an antibody targeting the histone modification H3K27-acetylation (H3K27ac). Notice the presence of Cyanin-3 (Cy3)-labeled DNA probes delimiting the DNA array composed of 32 × 32 interstitially printed probes. ( Middle ) DAPI staining. ( Right ) Digital map displaying the normalized read counts captured per physical position (SpExel) across the mouse embryo section. ( B ) t-SNE analysis allowing to stratify SpExel in six different clusters. ( Right ) Projection of the stratified clusters within the digital map. ( C ) Tissue–cell type gene marker association analysis performed per clusters identified in B . ( D ) Local enrichment signatures associated with six gene promoters presenting H3K27ac overrepresented counts. ( E ) In situ hybridization (ISH) and gene expression data (Allen Mouse Brain Atlas) for the genes Sox10 and Lhx5 , revealing their spatial signature, which is coherent with the H3K27ac digitized view displayed in D . ( F , left to right ) Histone modification immunostaining (TRITC filter: H3K4me3, H3K27me3), nuclei revealed by DAPI, digital map of the normalized read counts across the tissue section, and local read count enrichment associated to the gene Wnt11 . ( G ) Strategy for interrogating changes in chromatin histone modification signatures across the embryo: ( i ) overlay all three histone modification maps, ( ii ) generate a pseudomap in which SpExel of each digitized map are allocated to common pseudocoordinates, and ( iii ) interrogate for contiguous enrichment patterns similarity within tissue section but also across all three aligned sections. ( H ) Pseudomap obtained from the overlay of all three histone modification digital maps. ( I ) Promoter enrichment patterns associated to Wnt11 gene (more than five contiguous SpExel) retrieved in either of the histone modification maps. ( J ) Spatial gene promoter's coenrichment analysis for Wnt11 in the H3K27ac or H3K27me3 digital map. SpExel colored in red correspond to the location of Wnt11 , whereas others correspond to other gene promoters sharing a similar spatial pattern (Tanimoto similarity index). Notice that these two spatial gene promoter's coenrichment maps present distinct spatial localizations. ( K ) Heatmap displaying the co-occurring promoter enrichment patterns between all three histone modifications. Six chromatin co-occurring states were identified and functionally associated to either active, repressed, or bivalent promoters, as described previously ( , ). Notice the presence of two states for which no functional association has been attributed: H3K4me3, or H3K27ac alone. ( L ) Gene promoters presenting different chromatin co-occurring states across the tissue. ( M , top ) Local read counts promoter enrichment for the gene Hoxb4 in either of the histone modification maps within the pseudomap. ( Bottom ) Hoxb4 coenrichment patterns revealing the presence of either bivalent (H3K27me3/H3K27ac or H3K27me3/H3K4me3) or promoter active regions (H3K27ac/H3K4me3). ( N ) In situ hybridization (ISH) and gene expression data (Allen Mouse Brain Atlas) for the gene Hoxb4 , revealing its spatial signature coherent with the H3K27ac digitized view displayed in M .

Article Snippet: Like in our previous study describing the use of double-barcoded DNA arrays for spatial transcriptomics , we have used BCr oligonucleotides presenting an amino C6 linker at the 5′ extremity, followed by four G or C nucleotides (S), a T7 promoter sequence (GACTCGTAATACGACTCACTATAGGG), a unique molecular identifier (UMI; WSNNWSNNV), a molecular barcode (8 nt) associated to the printed row in the DNA array, and a 30 nt adapter sequence with a GC-content of 40% (here named as Gibson sequence “ACATTGAAGAACCTG-TAGATAACTCGCTGT”).

Techniques: DNA Array, Modification, Labeling, Staining, Marker, In Situ Hybridization, Gene Expression, Immunostaining, Functional Assay